pJE53
(Plasmid
#194153)
-
PurposesgRNA expression in A. baumannii for CRISPRi. Replicative plasmid, KmR. Contains mrfp nontargeting control guide sequence.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 194153 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepYDE007
- Backbone size w/o insert (bp) 8854
- Total vector size (bp) 9000
-
Modifications to backboneThe EcoRI-PstI fragment of pYDE007 (containing bla) was replaced with a PCR product containing the kanamycin resistance gene from pDL1100 and the same restriction sites.
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namesgRNA with mrfp control guide sequence
-
gRNA/shRNA sequenceAACTTTCAGTTTAGCGGTCT
- Promoter J23119
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SpeI (not destroyed)
- 3′ cloning site ApaI (not destroyed)
- 5′ sequencing primer TCAGGCACCGTGTATGAAATC
- 3′ sequencing primer TCCTACGAGTTGCATGATAAAG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJE53 was a gift from Edward Geisinger (Addgene plasmid # 194153 ; http://n2t.net/addgene:194153 ; RRID:Addgene_194153) -
For your References section:
Essential Gene Analysis in Acinetobacter baumannii by High-Density Transposon Mutagenesis and CRISPR Interference. Bai J, Dai Y, Farinha A, Tang AY, Syal S, Vargas-Cuebas G, van Opijnen T, Isberg RR, Geisinger E. J Bacteriol. 2021 May 20;203(12):e0056520. doi: 10.1128/JB.00565-20. Epub 2021 Mar 29. 10.1128/JB.00565-20 PubMed 33782056