Skip to main content

pJE53
(Plasmid #194153)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 194153 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pYDE007
  • Backbone size w/o insert (bp) 8854
  • Total vector size (bp) 9000
  • Modifications to backbone
    The EcoRI-PstI fragment of pYDE007 (containing bla) was replaced with a PCR product containing the kanamycin resistance gene from pDL1100 and the same restriction sites.
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    sgRNA with mrfp control guide sequence
  • gRNA/shRNA sequence
    AACTTTCAGTTTAGCGGTCT
  • Promoter J23119

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SpeI (not destroyed)
  • 3′ cloning site ApaI (not destroyed)
  • 5′ sequencing primer TCAGGCACCGTGTATGAAATC
  • 3′ sequencing primer TCCTACGAGTTGCATGATAAAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJE53 was a gift from Edward Geisinger (Addgene plasmid # 194153 ; http://n2t.net/addgene:194153 ; RRID:Addgene_194153)
  • For your References section:

    Essential Gene Analysis in Acinetobacter baumannii by High-Density Transposon Mutagenesis and CRISPR Interference. Bai J, Dai Y, Farinha A, Tang AY, Syal S, Vargas-Cuebas G, van Opijnen T, Isberg RR, Geisinger E. J Bacteriol. 2021 May 20;203(12):e0056520. doi: 10.1128/JB.00565-20. Epub 2021 Mar 29. 10.1128/JB.00565-20 PubMed 33782056