pET-MhCINS-6xHis
(Plasmid
#194304)
-
PurposeBacterial expression of MhCINS protein with a C terminal His-tag and transit peptide removed at N terminal
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 194304 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepET29
-
Backbone manufacturerNovagen
- Backbone size w/o insert (bp) 5150
- Total vector size (bp) 6758
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMhCINS
-
Alt nameMhTPS
-
SpeciesMeiogyne heteropetala
-
Insert Size (bp)1608
- Promoter T7
-
Tag
/ Fusion Protein
- 6xHis (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer TCTCTATCTAGAAGGAGGTATAATATGCGGAGATCTGCTAATTATC
- 3′ sequencing primer GTGATGGGATCCGCCGTCAAGTGGTATTGGTTCAGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET-MhCINS-6xHis was a gift from Richard Saunders (Addgene plasmid # 194304 ; http://n2t.net/addgene:194304 ; RRID:Addgene_194304) -
For your References section:
Aerial litter mimicry: A novel form of floral deception mediated by a monoterpene synthase. Liu M-F, Chen J, Goodrich KR, Chiu SK, Pang CC, Scharaschkin T, Saunders RMK. J Ecology 2024; 00, 1–20. doi: 10.1111/1365-2745.14446 10.1111/1365-2745.14446