Skip to main content

pECNUS_P2
(Plasmid #194344)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 194344 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pICH47742
  • Backbone size w/o insert (bp) 4968
  • Total vector size (bp) 5327
  • Vector type
    Plant Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgRNA expression cassettes and LacZ
  • Species
    A. thaliana (mustard weed)
  • Insert Size (bp)
    975
  • Promoter Ath U6 promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaI (not destroyed)
  • 3′ cloning site BsaI (not destroyed)
  • 5′ sequencing primer CCTGTATCGAGTGGTGATTTTGTG
  • 3′ sequencing primer CGCCAATATATCCTGTCAAACACTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

sgRNA position entry clone, position 2. Modified based on pICH47742.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pECNUS_P2 was a gift from Eunyoung Chae (Addgene plasmid # 194344 ; http://n2t.net/addgene:194344 ; RRID:Addgene_194344)
  • For your References section:

    Generating minimum set of gRNA to cover multiple targets in multiple genomes with MINORg. Lee RR, Cher WY, Wang J, Chen Y, Chae E. Nucleic Acids Res. 2023 Mar 15:gkad142. doi: 10.1093/nar/gkad142. 10.1093/nar/gkad142 PubMed 36919598