Skip to main content

pECNUS_MP01
(Plasmid #194350)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 194350 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pAGM4723
  • Backbone size w/o insert (bp) 4800
  • Total vector size (bp) 14307
  • Vector type
    Plant Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    pcoCas9, FAST-Red
  • Species
    A. thaliana (mustard weed)
  • Insert Size (bp)
    8000
  • Promoter RPS5A

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer gtacaatctgctctgatgccgc
  • 3′ sequencing primer gattacatggcaacccaaact
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

pECNUS_MP01 is a binary vector, it contains BpiI cutter flanking LacZ, proper for cloning with <= 6 sgRNA expression cassettes.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pECNUS_MP01 was a gift from Eunyoung Chae (Addgene plasmid # 194350 ; http://n2t.net/addgene:194350 ; RRID:Addgene_194350)
  • For your References section:

    Generating minimum set of gRNA to cover multiple targets in multiple genomes with MINORg. Lee RR, Cher WY, Wang J, Chen Y, Chae E. Nucleic Acids Res. 2023 Mar 15:gkad142. doi: 10.1093/nar/gkad142. 10.1093/nar/gkad142 PubMed 36919598