Skip to main content

NFlhb-t2a-GFP
(Plasmid #194357)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 194357 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLV
  • Backbone size w/o insert (bp) 7000
  • Total vector size (bp) 8209
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    luteinizing hormone subunit beta
  • Alt name
    lhb
  • Species
    Nothobranchius furzeri
  • Tag / Fusion Protein
    • t2a-GFP

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ATGGTGCTTCAGGCCAGTAAAGAGA
  • 3′ sequencing primer GTAGTAAAAGGTAATGTCATTCATG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    NFlhb-t2a-GFP was a gift from Itamar Harel (Addgene plasmid # 194357 ; http://n2t.net/addgene:194357 ; RRID:Addgene_194357)
  • For your References section:

    The killifish germline regulates longevity and somatic repair in a sex-specific manner. Moses E, Atlan T, Sun X, Franek R, Siddiqui A, Marinov GK, Shifman S, Zucker DM, Oron-Gottesman A, Greenleaf WJ, Cohen E, Ram O, Harel I. Nat Aging. 2024 Jun;4(6):791-813. doi: 10.1038/s43587-024-00632-0. Epub 2024 May 15. 10.1038/s43587-024-00632-0 PubMed 38750187