YN2_1_IL50_HOlocus
(Plasmid
#194426)
-
PurposeExpresses Cas9 and sgRNA cassettes for targeting the HO locus in yeast Saccharomyces cerevisiae
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 194426 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneMoClo YTK
-
Vector typeYeast Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCas9
-
gRNA/shRNA sequenceGCTCCAGCATTATAGCATGC
-
SpeciesS. cerevisiae (budding yeast)
-
MutationNA
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (destroyed during cloning)
- 3′ cloning site BsmBI (destroyed during cloning)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
YN2_1_IL50_HOlocus was a gift from Lisbeth Olsson (Addgene plasmid # 194426 ; http://n2t.net/addgene:194426 ; RRID:Addgene_194426) -
For your References section:
ScEnSor Kit for Saccharomyces cerevisiae Engineering and Biosensor-Driven Investigation of the Intracellular Environment. Torello Pianale L, Olsson L. ACS Synth Biol. 2023 Aug 8. doi: 10.1021/acssynbio.3c00124. 10.1021/acssynbio.3c00124 PubMed 37552581