pCS2TAL3-DD-zrif1_exon8
(Plasmid
#194435)
-
PurposeLeft (DD) TALEN for mutating zebrafish rif1 gene
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 194435 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCS2TAL3-DD
-
Vector typeTALEN
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namezrif1_ex8_LEFT
-
SpeciesD. rerio (zebrafish)
-
Entrez Generif1 (a.k.a. fc38c03, si:dkey-89p3.2, wu:fc38c03)
- Promoter CMV IE94
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer TTGGCGTCGGCAAACAGTGG
- 3′ sequencing primer GGCAACGCGATGGGACGT
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2022.10.21.512903v1 for preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCS2TAL3-DD-zrif1_exon8 was a gift from Christopher Sansam (Addgene plasmid # 194435 ; http://n2t.net/addgene:194435 ; RRID:Addgene_194435) -
For your References section:
Zebrafish Rif1 impacts zygotic genome activation, replication timing, and sex determination. Masser EA, Noble TD, Siefert JC, Goins D, Sansam CG, Sansam CL. eLife 2023 (Reviewed Preprint) 12:RP87671 10.7554/eLife.87671.1