Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pORE303N_CEN1
(Plasmid #194439)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 194439 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pORE-R1
  • Vector type
    Plant Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    gRNA targeting CEN1
  • gRNA/shRNA sequence
    GTATCAGTCCAGCAGGAAGC
  • Species
    Medicago truncatula, Populus spp.
  • Promoter MtU6

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GCTTGGGAATGATGACTCATG
  • 3′ sequencing primer GAGTGTCGTGCTCCACCATGT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pORE303N_CEN1 was a gift from Chung-Jui Tsai (Addgene plasmid # 194439 ; http://n2t.net/addgene:194439 ; RRID:Addgene_194439)
  • For your References section:

    In vitro floral development in poplar: insights into seed trichome regulation and trimonoecy. Ortega MA, Zhou R, Chen MSS, Bewg WP, Simon B, Tsai CJ. New Phytol. 2022 Nov 16. doi: 10.1111/nph.18624. 10.1111/nph.18624 PubMed 36385612