pMET7-EDHFR-FKBP12
(Plasmid
#194454)
-
PurposeMammalian expression vector that expresses the EDHFR protein with FKBP12 fused to it
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 194454 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepMET7
- Backbone size w/o insert (bp) 2973
- Total vector size (bp) 3813
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFKBP12
-
Alt nameFKBP1A
-
SpeciesH. sapiens (human)
-
Insert Size (bp)840
-
Entrez GeneFKBP1A (a.k.a. FKBP-12, FKBP-1A, FKBP1, FKBP12, PKC12, PKCI2, PPIASE)
- Promoter SR alpha
-
Tag
/ Fusion Protein
- eDHFR (N terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer ATCAAAGAACTGCTCCTC
- 3′ sequencing primer GTAACCATTATAAGCTGCAA
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMET7-EDHFR-FKBP12 was a gift from Sven Eyckerman (Addgene plasmid # 194454 ; http://n2t.net/addgene:194454 ; RRID:Addgene_194454) -
For your References section:
A decoupled Virotrap approach to study the interactomes of N-terminal proteoforms. Bogaert A, Van de Steene T, Vuylsteke M, Eyckerman S, Gevaert K. Methods Enzymol. 2023;684:253-287. doi: 10.1016/bs.mie.2023.02.003. Epub 2023 Mar 10. 10.1016/bs.mie.2023.02.003 PubMed 37230591