Skip to main content

pMET7-GAG-FRB
(Plasmid #194455)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 194455 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pMET7-GAG
  • Backbone size w/o insert (bp) 4573
  • Total vector size (bp) 4873
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    FRB
  • Alt name
    mTOR domain
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    300
  • Entrez Gene
    MTOR (a.k.a. FRAP, FRAP1, FRAP2, RAFT1, RAPT1, SKS)
  • Promoter SR alpha
  • Tag / Fusion Protein
    • GAG (N terminal on backbone)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer ATCAAAGAACTGCTCCTC
  • 3′ sequencing primer GTAACCATTATAAGCTGCAA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMET7-GAG-FRB was a gift from Sven Eyckerman (Addgene plasmid # 194455 ; http://n2t.net/addgene:194455 ; RRID:Addgene_194455)
  • For your References section:

    A decoupled Virotrap approach to study the interactomes of N-terminal proteoforms. Bogaert A, Van de Steene T, Vuylsteke M, Eyckerman S, Gevaert K. Methods Enzymol. 2023;684:253-287. doi: 10.1016/bs.mie.2023.02.003. Epub 2023 Mar 10. 10.1016/bs.mie.2023.02.003 PubMed 37230591