pMET7-GAG-eDHFR
(Plasmid
#194635)
-
PurposeMammalian expression of the eDHFR control bait in Virotrap
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 194635 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepMET7
- Backbone size w/o insert (bp) 2956
- Total vector size (bp) 6278
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namep55 GAG
-
Alt namegag
-
SpeciesHIV1
-
Insert Size (bp)1500
- Promoter SRalpha
-
Tag
/ Fusion Protein
- ecDHFR (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site none (unknown if destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer ATCAAAGAACTGCTCCTC
- 3′ sequencing primer GTAACCATTATAAGCTGCAA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMET7-GAG-eDHFR was a gift from Sven Eyckerman (Addgene plasmid # 194635 ; http://n2t.net/addgene:194635 ; RRID:Addgene_194635) -
For your References section:
Trapping mammalian protein complexes in viral particles. Eyckerman S, Titeca K, Van Quickelberghe E, Cloots E, Verhee A, Samyn N, De Ceuninck L, Timmerman E, De Sutter D, Lievens S, Van Calenbergh S, Gevaert K, Tavernier J. Nat Commun. 2016 Apr 28;7:11416. doi: 10.1038/ncomms11416. 10.1038/ncomms11416 PubMed 27122307