Skip to main content

p72B9-FBL-HC
(Plasmid #194637)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 194637 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA3.4
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    72B9 antibody, heavy chain
  • Species
    M. musculus (mouse)
  • Promoter CMV

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer CATAGCGTAAAAGGAGCAACA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Addgene QC NGS identifies a P151L discrepancy in HVM63_MOUSE. The depositing laboratory has confirmed that this should not impact function.

Please note that both plasmids, heavy chain (plasmid 194637) and light chain (plasmid 194638), are required to make the antibody. For initial characterization of the 72B9 antibody see: https://pubmed.ncbi.nlm.nih.gov/2441711/.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    p72B9-FBL-HC was a gift from Susan Baserga (Addgene plasmid # 194637 ; http://n2t.net/addgene:194637 ; RRID:Addgene_194637)