p72B9-FBL-LC
(Plasmid
#194638)
-
PurposeExpresses 72B9 hybridoma anti-FBL antibody, light chain
-
Depositing Lab
-
Sequence Information
-
Sequences (1) — Accept Affinity Reagent Sequence Policy
-
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 194638 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA3.4
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert name72B9 antibody, light chain
-
SpeciesM. musculus (mouse)
- Promoter CMV
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer CATAGCGTAAAAGGAGCAACA (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note that both plasmids, heavy chain (plasmid 194637) and light chain (plasmid 194638), are required to make the antibody. For initial characterization of the 72B9 antibody see: https://pubmed.ncbi.nlm.nih.gov/2441711/.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p72B9-FBL-LC was a gift from Susan Baserga (Addgene plasmid # 194638 ; http://n2t.net/addgene:194638 ; RRID:Addgene_194638)