pABE8e-NG-403Q-Cterm-AAV
              
              
                (Plasmid
                
                #194652)
              
            
            
            
          - 
            PurposeC-terminal AAV genome plasmid encoding ABE8e + sgRNA to correct the R403Q mutation in mice
- 
              Depositing Lab
- 
          Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 194652 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
- 
          SerotypeSelect serotype for details See details about
- 
          PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
- 
          How this works- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
 
Backbone
- 
            Vector backbonemodified pX601
- Backbone size w/o insert (bp) 4735
- Total vector size (bp) 7348
- 
              Vector typeAAV
Growth in Bacteria
- 
            Bacterial Resistance(s)Ampicillin, 100 μg/mL
- 
            Growth Temperature37°C
- 
            Growth Strain(s)NEB Stable
- 
            Copy numberUnknown
Gene/Insert
- 
                Gene/Insert nameABE8e-NG C-term
- 
                  Alt nameABE8e-SpCas9-NG
- 
                  Alt nameABE8e
- 
                    SpeciesSynthetic
- 
                  Insert Size (bp)2613
- Promoter TNNT2
- 
    
        Tags
        / Fusion Proteins
    - BPNLS (N terminal on insert)
- BPNLS (C terminal on insert)
- NpuC split intein (N terminal on insert)
 
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TAGGCTAGCCTCGAGAATTCAC
- 3′ sequencing primer GGCACAGTCGCACCACGGAATTGTCAGTGCC (Common Sequencing Primers)
Resource Information
- 
            
            
            Supplemental Documents
Terms and Licenses
- 
        Academic/Nonprofit Terms
- 
      Industry Terms- Not Available to Industry
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              For your Materials & Methods section: pABE8e-NG-403Q-Cterm-AAV was a gift from David Liu (Addgene plasmid # 194652 ; http://n2t.net/addgene:194652 ; RRID:Addgene_194652)
- 
                For your References section: Efficient in vivo genome editing prevents hypertrophic cardiomyopathy in mice. Reichart D, Newby GA, Wakimoto H, Lun M, Gorham JM, Curran JJ, Raguram A, DeLaughter DM, Conner DA, Marsiglia JDC, Kohli S, Chmatal L, Page DC, Zabaleta N, Vandenberghe L, Liu DR, Seidman JG, Seidman C. Nat Med. 2023 Feb;29(2):412-421. doi: 10.1038/s41591-022-02190-7. Epub 2023 Feb 16. 10.1038/s41591-022-02190-7 PubMed 36797483
