PATL2_G288-Y543_BV_his
(Plasmid
#194760)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 194760 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 * | |
* Log in to view industry pricing.
Backbone
-
Vector backbonepFBOH-MHL
-
Backbone manufacturerSGC (Addgene Plasmid #62304)
-
Vector typeBaculovirus Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePATL2
-
Alt namePATL2:PBC038-A09:C247514
-
SpeciesH. sapiens (human)
-
Entrez GenePATL2 (a.k.a. Pat1a, hPat1a)
- Promoter Polyhedrin
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer pFBOH-FWD:CCGGATTATTCATACCGTCCCACCA
- 3′ sequencing primer pFBOH-REV:CTGATTATGATCCTCTAGTACTTCT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
SGC openlab notebooks link: https://openlabnotebooks.org/assessing-patl2-as-a-non-hormonal-contraceptive-target/
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PATL2_G288-Y543_BV_his was a gift from Cheryl Arrowsmith (Addgene plasmid # 194760 ; http://n2t.net/addgene:194760 ; RRID:Addgene_194760)