pHEE401_GV_MOD
(Plasmid
#194874)
-
PurposemCherry selection in Arabidopsis seeds in T1 and T2
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 194874 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepHEE401E
-
Vector typeCRISPR
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCas9
-
SpeciesA. thaliana (mustard weed)
-
Insert Size (bp)19400
- Promoter egg cell-specific
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer atggattacaaggaccacgacggg
- 3′ sequencing primer gaagaagaagtga (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHEE401_GV_MOD was a gift from Wolfgang Busch (Addgene plasmid # 194874 ; http://n2t.net/addgene:194874 ; RRID:Addgene_194874) -
For your References section:
ClearDepth: a simple, robust, and low-cost method to assess root depth in soil. Ruiz Rosquete M, Gonzalez J, Wertz K, Gonzalez N, Baez M, Wang L, Zhang L, Patil S, Funaro L, Busch W. Plant J. 2025 Jan;121(1):e17177. doi: 10.1111/tpj.17177. Epub 2024 Dec 8. 10.1111/tpj.17177 PubMed 39645605