Skip to main content
Addgene

pLX311-GFP-MEKDD
(Plasmid #194882)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 194882 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLX311-GFP
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    GFP

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    MEKDD
  • Alt name
    Dominant Negative MEK1
  • Species
    H. sapiens (human)
  • Mutation
    S218D, S222D
  • GenBank ID
    5604
  • Entrez Gene
    MAP2K1 (a.k.a. CFC3, MAPKK1, MEK1, MEL, MKK1, PRKMK1)
  • Promoter E1Fa

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer cgtgaggctagcatcgattgatcaac
  • 3′ sequencing primer CTTTCTTGTACaaagtggttg
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLX311-GFP-MEKDD was a gift from Sefi Rosenbluh (Addgene plasmid # 194882 ; http://n2t.net/addgene:194882 ; RRID:Addgene_194882)
  • For your References section:

    CRISPR screens identify gene targets at breast cancer risk loci. Tuano NK, Beesley J, Manning M, Shi W, Perlaza-Jimenez L, Malaver-Ortega LF, Paynter JM, Black D, Civitarese A, McCue K, Hatzipantelis A, Hillman K, Kaufmann S, Sivakumaran H, Polo JM, Reddel RR, Band V, French JD, Edwards SL, Powell DR, Chenevix-Trench G, Rosenbluh J. Genome Biol. 2023 Mar 29;24(1):59. doi: 10.1186/s13059-023-02898-w. 10.1186/s13059-023-02898-w PubMed 36991492