pLX311-GFP-MEKDD
(Plasmid
#194882)
-
PurposeExpression of dominant negative MEK1
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 194882 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLX311-GFP
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersGFP
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMEKDD
-
Alt nameDominant Negative MEK1
-
SpeciesH. sapiens (human)
-
MutationS218D, S222D
-
GenBank ID5604
-
Entrez GeneMAP2K1 (a.k.a. CFC3, MAPKK1, MEK1, MEL, MKK1, PRKMK1)
- Promoter E1Fa
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer cgtgaggctagcatcgattgatcaac
- 3′ sequencing primer CTTTCTTGTACaaagtggttg (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLX311-GFP-MEKDD was a gift from Sefi Rosenbluh (Addgene plasmid # 194882 ; http://n2t.net/addgene:194882 ; RRID:Addgene_194882) -
For your References section:
CRISPR screens identify gene targets at breast cancer risk loci. Tuano NK, Beesley J, Manning M, Shi W, Perlaza-Jimenez L, Malaver-Ortega LF, Paynter JM, Black D, Civitarese A, McCue K, Hatzipantelis A, Hillman K, Kaufmann S, Sivakumaran H, Polo JM, Reddel RR, Band V, French JD, Edwards SL, Powell DR, Chenevix-Trench G, Rosenbluh J. Genome Biol. 2023 Mar 29;24(1):59. doi: 10.1186/s13059-023-02898-w. 10.1186/s13059-023-02898-w PubMed 36991492