GH-t2a GFP
(Plasmid
#194883)
-
Purposean overexpression vector of the killifish growth hormone
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 194883 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLV
- Backbone size w/o insert (bp) 7000
- Total vector size (bp) 8380
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namegrowth hormone
-
Alt nameGH
-
SpeciesNothobranchius furzeri
-
Insert Size (bp)611
-
GenBank IDXM_015966915.1
- Promoter CMV
-
Tag
/ Fusion Protein
- t2a-GFP
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ATGGACAGAGCCCTCCTCCTCC
- 3′ sequencing primer CAGAGTGCAGTTTGCTTCTGGA
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byoriginal cloning
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
GH-t2a GFP was a gift from Itamar Harel (Addgene plasmid # 194883 ; http://n2t.net/addgene:194883 ; RRID:Addgene_194883) -
For your References section:
A scalable and tunable platform for functional interrogation of peptide hormones in fish. Moses E, Franek R, Harel I. eLife. 2023 Oct 24;12:e85960. doi: 10.7554/eLife.85960. 10.7554/eLife.85960 PubMed 37872843