Skip to main content

FUW-crRNA1and2-U6_TRE-dLbCpf1-NLS-hCTCF_K365A_R368A-HA-P2A-tagBFP
(Plasmid #194886)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 194886 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    Fuw
  • Backbone size w/o insert (bp) 5946
  • Total vector size (bp) 15631
  • Modifications to backbone
    Fuw-TRE-HA-P2A-tagBFP
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    tagBFP by FACS

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    dLbCpf1-NLS-hCTCF_K365A_R368A
  • Species
    Synthetic
  • Insert Size (bp)
    5946
  • Mutation
    Human codon optimized catalytically inactive LbCpf1 (dLbCpf1) with mutation of D832A; CTCF with mutations of K365A and R368A
  • Promoter TRE
  • Tag / Fusion Protein
    • HA (C terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer cgtatgcagactttactccc
  • 3′ sequencing primer taaagcagcgtatcc
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    U6-crRNA1and2
  • Species
    Synthetic
  • Insert Size (bp)
    359
  • Promoter U6

Cloning Information for Gene/Insert 2

Resource Information

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Zeo marker is outside the LTRs and will not be packaged into virus.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    FUW-crRNA1and2-U6_TRE-dLbCpf1-NLS-hCTCF_K365A_R368A-HA-P2A-tagBFP was a gift from Shawn Liu (Addgene plasmid # 194886 ; http://n2t.net/addgene:194886 ; RRID:Addgene_194886)
  • For your References section:

    Multiplex epigenome editing of MECP2 to rescue Rett syndrome neurons. Qian J, Guan X, Xie B, Xu C, Niu J, Tang X, Li CH, Colecraft HM, Jaenisch R, Liu XS. Sci Transl Med. 2023 Jan 18;15(679):eadd4666. doi: 10.1126/scitranslmed.add4666. Epub 2023 Jan 18. 10.1126/scitranslmed.add4666 PubMed 36652535