pKK1 -pFlp-18::mito4x-GCaMP6f
              
              
                (Plasmid
                
                #194969)
              
            
            
            
          - 
            PurposeFluorescent reporter of mitochondrial matrix Ca2+.
- 
              Depositing Lab
- 
          Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 194969 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 * | |
* Log in to view industry pricing.
Backbone
- 
            Vector backbonepCFJ150
- Backbone size w/o insert (bp) 12204
- Total vector size (bp) 13574
- 
              Vector typeWorm Expression
Growth in Bacteria
- 
            Bacterial Resistance(s)Ampicillin, 100 μg/mL
- 
            Growth Temperature37°C
- 
            Growth Strain(s)DH5alpha
- 
            Copy numberUnknown
Gene/Insert
- 
                Gene/Insert name4 repeats of Cox8 presequence plus GCaMP6f
- 
                    SpeciesSynthetic
- 
                  Insert Size (bp)1800
- Promoter Flp-18
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CTGGTGTGACTTCTTCCTTCTTCG (Common Sequencing Primers)
Resource Information
- 
            
            
            Supplemental Documents
- 
            A portion of this plasmid was derived from a plasmid made bymito4x-GCaMP6f was amplified from Addgene plasmid 127870
Terms and Licenses
- 
        Academic/Nonprofit Terms
- 
      Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Ashrafi G, de Juan-Sanz J, Farrell RJ, Ryan TA. Molecular Tuning of the Axonal Mitochondrial Ca2+ Uniporter Ensures Metabolic Flexibility of Neurotransmission. Neuron. 2020 Feb 19;105(4):678-687.e5. doi: 10.1016/j.neuron.2019.11.020. Epub 2019 Dec 17. PMID: 31862210; PMCID: PMC7035162.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              For your Materials & Methods section: pKK1 -pFlp-18::mito4x-GCaMP6f was a gift from Frederic Hoerndli (Addgene plasmid # 194969 ; http://n2t.net/addgene:194969 ; RRID:Addgene_194969)
