(D) crtE (E)_G1 (SBE115)
(Plasmid
#194994)
-
PurposeRhodotorula toruloides gene geranylgeranyl diphosphate synthase (crtE, RHTO_02504) for G1
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 194994 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepJET 1.2
- Backbone size w/o insert (bp) 3004
- Total vector size (bp) 4507
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert name(D) crtE (E)
-
SpeciesRhodotorula toruloides
-
Insert Size (bp)1508
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CCATATCCATCCGGCGTAAT
- 3′ sequencing primer CCTGATGAGGTGGTTAGCAT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
(D) crtE (E)_G1 (SBE115) was a gift from Petri-Jaan Lahtvee (Addgene plasmid # 194994 ; http://n2t.net/addgene:194994 ; RRID:Addgene_194994) -
For your References section:
Development of a dedicated Golden Gate Assembly Platform (RtGGA) for Rhodotorula toruloides. Bonturi N, Pinheiro MJ, de Oliveira PM, Rusadze E, Eichinger T, Liudziute G, De Biaggi JS, Brauer A, Remm M, Miranda EA, Ledesma-Amaro R, Lahtvee PJ. Metab Eng Commun. 2022 May 23;15:e00200. doi: 10.1016/j.mec.2022.e00200. eCollection 2022 Dec. 10.1016/j.mec.2022.e00200 PubMed 35662893