pOTTC1642 - pAAV EF1a EGFP-KASH with mTACR1 gRNAs
(Plasmid
#195018)
-
PurposeAn adeno-associated viral vector expressing eGFP-KASH and two guides targeting mouse TACR1
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 195018 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepOTTC1553
-
Backbone manufacturerNIDA GEVVC
- Backbone size w/o insert (bp) 6400
- Total vector size (bp) 7200
-
Modifications to backboneguide RNA expression cassettes were inserted into pAAV EF1a EGFP-KASH
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert nameCCGTATAGGCGGCTGCCCAA
-
Alt nameTacr1 gRNA 1 A55
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)20
-
GenBank IDNC_000072.7
- Promoter mU6
Cloning Information for Gene/Insert 1
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CCTCGCACAGACTTGTGGGA
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameEGFP-KASH
-
SpeciesSynthetic
-
Insert Size (bp)984
- Promoter EF1a
-
Tag
/ Fusion Protein
- KASH domain of Nesprin2 (C terminal on insert)
Cloning Information for Gene/Insert 2
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CAAGCCTCAGACAGTGGTTC
- (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameTTCCGTGGTGGGCAACGTAG
-
Alt nameTacr1 gRNA 2 B108
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)20
-
GenBank IDNC_000072.7
- Promoter hU6
Cloning Information for Gene/Insert 3
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer AAATGGACTATCATATGCTTACCGTAACTTGAAAG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pOTTC1642 - pAAV EF1a EGFP-KASH with mTACR1 gRNAs was a gift from Christopher Richie (Addgene plasmid # 195018 ; http://n2t.net/addgene:195018 ; RRID:Addgene_195018) -
For your References section:
Nucleus Accumbens Local Circuit for Cue-Dependent Aversive Learning. Belilos A, Gray C, Sanders C, Black D, Mays E, Richie CT, Sengupta A, Hake HS, Francis TC. bioRxiv [Preprint]. 2023 Oct 9:2023.02.06.527338. doi: 10.1101/2023.02.06.527338. 10.1101/2023.02.06.527338 PubMed 36798245