Skip to main content
Addgene

pMtnA FLAG-IntS6 puro
(Plasmid #195076)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 195076 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pMT FLAG MCS puro
  • Total vector size (bp) 8610
  • Vector type
    Insect Expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    IntS6
  • Species
    D. melanogaster (fly)
  • Entrez Gene
    IntS6 (a.k.a. Dmel_CG3125, CG3125, Dmel\CG3125, Int6, l(1)G0060)
  • Promoter MtnA
  • Tag / Fusion Protein
    • 3xFLAG (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SpeI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer gtgtgtaaagccgcgtttcc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMtnA FLAG-IntS6 puro was a gift from Jeremy Wilusz (Addgene plasmid # 195076 ; http://n2t.net/addgene:195076 ; RRID:Addgene_195076)
  • For your References section:

    IntS6 and the Integrator phosphatase module tune the efficiency of select premature transcription termination events. Fujiwara R, Zhai SN, Liang D, Shah AP, Tracey M, Ma XK, Fields CJ, Mendoza-Figueroa MS, Meline MC, Tatomer DC, Yang L, Wilusz JE. Mol Cell. 2023 Nov 14:S1097-2765(23)00902-4. doi: 10.1016/j.molcel.2023.10.035. 10.1016/j.molcel.2023.10.035 PubMed 37995689