pMtnA FLAG-IntS12 puro
(Plasmid
#195077)
-
PurposeExpresses FLAG-tagged Drosophila IntS12 from inducible MtnA promoter
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 195077 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepMT FLAG MCS puro
- Total vector size (bp) 5775
-
Vector typeInsect Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameIntegrator 12
-
Alt nameIntS12
-
SpeciesD. melanogaster (fly)
-
Entrez GeneIntS12 (a.k.a. Dmel_CG5491, CG5491, Dmel\CG5491, Int12)
- Promoter MtnA
-
Tag
/ Fusion Protein
- 3xFLAG (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SpeI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer gtgtgtaaagccgcgtttcc
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMtnA FLAG-IntS12 puro was a gift from Jeremy Wilusz (Addgene plasmid # 195077 ; http://n2t.net/addgene:195077 ; RRID:Addgene_195077) -
For your References section:
IntS6 and the Integrator phosphatase module tune the efficiency of select premature transcription termination events. Fujiwara R, Zhai SN, Liang D, Shah AP, Tracey M, Ma XK, Fields CJ, Mendoza-Figueroa MS, Meline MC, Tatomer DC, Yang L, Wilusz JE. Mol Cell. 2023 Nov 14:S1097-2765(23)00902-4. doi: 10.1016/j.molcel.2023.10.035. 10.1016/j.molcel.2023.10.035 PubMed 37995689