Skip to main content

pCDNA3.1_B1ChR2_TS_mScarlet_ER
(Plasmid #195191)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 195191 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCDNA3.1
  • Backbone size w/o insert (bp) 5340
  • Total vector size (bp) 7336
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Bilabrum sp. K+ selective channelrhodopsin 2
  • Alt name
    B1ChR2
  • Species
    Synthetic; Bilabrum sp
  • Insert Size (bp)
    1173
  • GenBank ID
    OP710242.1 UZU83955.1
  • Promoter CMV
  • Tags / Fusion Proteins
    • Kir2.1 trafficking motif (C terminal on insert)
    • mscarlet (C terminal on insert)
    • ER-export sequence (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer AGCCTCGACTGTGCCTTCTA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCDNA3.1_B1ChR2_TS_mScarlet_ER was a gift from Peter Hegemann & Johannes Vierock (Addgene plasmid # 195191 ; http://n2t.net/addgene:195191 ; RRID:Addgene_195191)
  • For your References section:

    WiChR, a highly potassium selective channelrhodopsin for low-light one- and two-photon inhibition of excitable cells. Vierock J, Peter E, Grimm C, Rozenberg A, Chen IW, Tillert L, Castro Scalise AG, Casini M, Augustin S, Tanese D, Forget BC, Peyronnet R, Schneider-Warme F, Emiliani V, Beja O, Hegemann P. Sci Adv. 2022 Nov 16:eadd7729. 10.1126/sciadv.add7729 PubMed 36383037