AAV-hSyn-ASAP3ER
              
              
                (Plasmid
                
                #195358)
              
            
            
            
          - 
            PurposeASAP3ER under control of human synapsin promoter
- 
              Depositing Lab
- 
          Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 195358 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
- 
          SerotypeSelect serotype for details See details about
- 
          PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
- 
          How this works- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
 
Backbone
- 
            Vector backboneAAV-hSyn
- Backbone size w/o insert (bp) 4559
- Total vector size (bp) 5849
- 
              Vector typeMammalian Expression, AAV
Growth in Bacteria
- 
            Bacterial Resistance(s)Ampicillin, 100 μg/mL
- 
            Growth Temperature37°C
- 
            Growth Strain(s)NEB Stable
- 
            Copy numberHigh Copy
Gene/Insert
- 
                Gene/Insert nameASAP3ER
- 
                    SpeciesSynthetic
- 
                  Insert Size (bp)1290
- Promoter human synapsin
- 
    
        Tag
        / Fusion Protein
    - GFP
 
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NCOI (unknown if destroyed)
- 3′ cloning site HindIII (unknown if destroyed)
- 5′ sequencing primer cggatcttctagagtcgacgc
- 3′ sequencing primer catagcgtaaaaggagcaaca (Common Sequencing Primers)
Terms and Licenses
- 
        Academic/Nonprofit Terms
- 
      Industry Terms- Not Available to Industry
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              For your Materials & Methods section: AAV-hSyn-ASAP3ER was a gift from Brenda Bloodgood (Addgene plasmid # 195358 ; http://n2t.net/addgene:195358 ; RRID:Addgene_195358)
- 
                For your References section: Electrical signals in the ER are cell type and stimulus specific with extreme spatial compartmentalization in neurons. Campbell EP, Abushawish AA, Valdez LA, Bell MK, Haryono M, Rangamani P, Bloodgood BL. Cell Rep. 2023 Jan 31;42(1):111943. doi: 10.1016/j.celrep.2022.111943. Epub 2023 Jan 5. 10.1016/j.celrep.2022.111943 PubMed 36640310
 
    
 
    
 
                         
             
            