pTet-Bxb1-CFP
(Plasmid
#195374)
-
PurposeExpresses Bxb1 integrase fused with CFP for fluorescence
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 195374 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneColE1
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBxb1 Integrase Fused With deCFP
-
SpeciesSynthetic
-
Insert Size (bp)4524
- Promoter pTet
-
Tag
/ Fusion Protein
- deCFP (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GGCGTATCACGAGGCAGAAT
- 3′ sequencing primer AAGGGCAGGGTGGTGACA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byDr. Victoria Hsiao originally cloned it at Murray lab, Caltech for this preprint: https://www.biorxiv.org/content/10.1101/121152v3
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Dr. Victoria Hsiao originally cloned this plasmid at Murray lab, Caltech for this preprint: https://www.biorxiv.org/content/10.1101/121152v3
We use this plasmid for in vitro cell-free protein expression system for our paper.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTet-Bxb1-CFP was a gift from Richard Murray (Addgene plasmid # 195374 ; http://n2t.net/addgene:195374 ; RRID:Addgene_195374) -
For your References section:
Characterization of Integrase and Excisionase Activity in a Cell-Free Protein Expression System Using a Modeling and Analysis Pipeline. Pandey A, Rodriguez ML, Poole W, Murray RM. ACS Synth Biol. 2023 Feb 17;12(2):511-523. doi: 10.1021/acssynbio.2c00534. Epub 2023 Jan 30. 10.1021/acssynbio.2c00534 PubMed 36715625