Skip to main content

pTet-Bxb1-CFP
(Plasmid #195374)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 195374 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    ColE1
  • Vector type
    Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Bxb1 Integrase Fused With deCFP
  • Species
    Synthetic
  • Insert Size (bp)
    4524
  • Promoter pTet
  • Tag / Fusion Protein
    • deCFP (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GGCGTATCACGAGGCAGAAT
  • 3′ sequencing primer AAGGGCAGGGTGGTGACA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Dr. Victoria Hsiao originally cloned this plasmid at Murray lab, Caltech for this preprint: https://www.biorxiv.org/content/10.1101/121152v3

We use this plasmid for in vitro cell-free protein expression system for our paper.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTet-Bxb1-CFP was a gift from Richard Murray (Addgene plasmid # 195374 ; http://n2t.net/addgene:195374 ; RRID:Addgene_195374)
  • For your References section:

    Characterization of Integrase and Excisionase Activity in a Cell-Free Protein Expression System Using a Modeling and Analysis Pipeline. Pandey A, Rodriguez ML, Poole W, Murray RM. ACS Synth Biol. 2023 Feb 17;12(2):511-523. doi: 10.1021/acssynbio.2c00534. Epub 2023 Jan 30. 10.1021/acssynbio.2c00534 PubMed 36715625