pU6-sgT-REX17_EF1a-Puro-T2A-BFP
(Plasmid
#195501)
-
PurposeLentiviral BFP expression vector bearing a sgRNA targeting the promoter of human T-REX17
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 195501 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepU6-sgRNA EF1Alpha-puro-T2A-BFP (Plasmid #60955)
-
Backbone manufacturerJonathan Weissman
- Backbone size w/o insert (bp) 8877
- Total vector size (bp) 8885
-
Modifications to backbonesgRNA sequence with a human unrelated target
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namesgRNA
-
gRNA/shRNA sequenceAGTGGTGTGGATTTCGGCAG
-
SpeciesH. sapiens (human)
-
GenBank IDhg19, chr8:55141135-55141154
-
Tags
/ Fusion Proteins
- Puro (C terminal on backbone)
- T2A (C terminal on backbone)
- BFP (C terminal on backbone)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bysgRNA was ordered from Sigma-Aldrich as synthetic ssODN oligonucleotide
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pU6-sgT-REX17_EF1a-Puro-T2A-BFP was a gift from Alexander Meissner (Addgene plasmid # 195501 ; http://n2t.net/addgene:195501 ; RRID:Addgene_195501) -
For your References section:
T-REX17 is a transiently expressed non-coding RNA essential for human endoderm formation. Landshammer A, Bolondi A, Kretzmer H, Much C, Buschow R, Rose A, Wu HJ, Mackowiak SD, Braendl B, Giesselmann P, Tornisiello R, Parsi KM, Huey J, Mielke T, Meierhofer D, Maehr R, Hnisz D, Michor F, Rinn JL, Meissner A. Elife. 2023 Jan 31;12:e83077. doi: 10.7554/eLife.83077. 10.7554/eLife.83077 PubMed 36719724