Pb459-mU6-sgRNA-EF1a-PuroR
(Plasmid
#195507)
-
Purposepiggybac vector expressing non-targeting control sgRNA cloned using BlpI and BstXI sites
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 195507 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepiggyBac
-
Vector typeMammalian Expression, CRISPR ; piggyBac
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePuromycin
-
gRNA/shRNA sequenceGCCGACTAGGGTCGATA
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site EcoR I (not destroyed)
- 5′ sequencing primer attctccttggaatttgccc
- 3′ sequencing primer cccgacgatatgatcctgat
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Pb459-mU6-sgRNA-EF1a-PuroR was a gift from Joanna Wysocka (Addgene plasmid # 195507 ; http://n2t.net/addgene:195507 ; RRID:Addgene_195507) -
For your References section:
A genome-wide genetic screen uncovers determinants of human pigmentation. Bajpai VK, Swigut T, Mohammed J, Naqvi S, Arreola M, Tycko J, Kim TC, Pritchard JK, Bassik MC, Wysocka J. Science. 2023 Aug 11;381(6658):eade6289. doi: 10.1126/science.ade6289. Epub 2023 Aug 11. 10.1126/science.ade6289 PubMed 37561850