pAct-dCBEevoAPOBEC1
(Plasmid
#195514)
-
PurposeUbiquitous expression of dCBEevoAPOBEC1 in Drosophila
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 195514 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepAct
- Total vector size (bp) 17719
-
Vector typeInsect Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namedCBE-evoAPOBEC1
-
SpeciesSynthetic
-
Insert Size (bp)5286
- Promoter act5C
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer GCATTCTTTCCATTGCAGCT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAct-dCBEevoAPOBEC1 was a gift from Michael Boutros (Addgene plasmid # 195514 ; http://n2t.net/addgene:195514 ; RRID:Addgene_195514) -
For your References section:
A temperature-tolerant CRISPR base editor mediates highly efficient and precise gene editing in Drosophila. Doll RM, Boutros M, Port F. Sci Adv. 2023 Sep;9(35):eadj1568. doi: 10.1126/sciadv.adj1568. Epub 2023 Aug 30. 10.1126/sciadv.adj1568 PubMed 37647411