Skip to main content

pAS_pb_Ef1a-TIR1_Ubc-mCherry-Puro
(Plasmid #195567)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 195567 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    PB-Ef1a_Ubc-mCherry-Puro
  • Total vector size (bp) 10586
  • Vector type
    Mammalian Expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TIR1
  • Species
    Oryza sativa
  • Insert Size (bp)
    1725
  • Promoter Ef1-alpha

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (unknown if destroyed)
  • 3′ cloning site NotI (unknown if destroyed)
  • 5′ sequencing primer tttctgttctgcgccgttac
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Wysocka lab (Addgene Plasmid #161972)

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAS_pb_Ef1a-TIR1_Ubc-mCherry-Puro was a gift from Joanna Wysocka (Addgene plasmid # 195567 ; http://n2t.net/addgene:195567 ; RRID:Addgene_195567)
  • For your References section:

    Co-transcriptional genome surveillance by HUSH is coupled to termination machinery. Spencley AL, Bar S, Swigut T, Flynn RA, Lee CH, Chen LF, Bassik MC, Wysocka J. Mol Cell. 2023 May 18;83(10):1623-1639.e8. doi: 10.1016/j.molcel.2023.04.014. Epub 2023 May 9. 10.1016/j.molcel.2023.04.014 PubMed 37164018