pAS_pb_Ef1a-TIR1_Ubc-mCherry-Puro
(Plasmid
#195567)
-
PurposePiggyBac plasmid for stable expression of TIR1, mCherry, and Puromycin resistance in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 195567 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonePB-Ef1a_Ubc-mCherry-Puro
- Total vector size (bp) 10586
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTIR1
-
SpeciesOryza sativa
-
Insert Size (bp)1725
- Promoter Ef1-alpha
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (unknown if destroyed)
- 3′ cloning site NotI (unknown if destroyed)
- 5′ sequencing primer tttctgttctgcgccgttac
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byWysocka lab (Addgene Plasmid #161972)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAS_pb_Ef1a-TIR1_Ubc-mCherry-Puro was a gift from Joanna Wysocka (Addgene plasmid # 195567 ; http://n2t.net/addgene:195567 ; RRID:Addgene_195567) -
For your References section:
Co-transcriptional genome surveillance by HUSH is coupled to termination machinery. Spencley AL, Bar S, Swigut T, Flynn RA, Lee CH, Chen LF, Bassik MC, Wysocka J. Mol Cell. 2023 May 18;83(10):1623-1639.e8. doi: 10.1016/j.molcel.2023.04.014. Epub 2023 May 9. 10.1016/j.molcel.2023.04.014 PubMed 37164018