Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

P-BT2818
(Plasmid #195742)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 195742 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pBolux
  • Backbone size w/o insert (bp) 13807
  • Total vector size (bp) 14107
  • Vector type
    Bacterial Expression
  • Selectable markers
    Tetracycline in Bacteroides species

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Pir1
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    The B. thetaiotaomicron BT2818 promoter cloned into pBolux
  • Species
    Bacteroides thetaiotaomicron
  • Insert Size (bp)
    300
  • Promoter BT2818

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer CGCCAGGGTTTTCCCAGTCACGAC
  • 3′ sequencing primer TGCGGACGTCAAATCAACAG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    P-BT2818 was a gift from Guy Townsend (Addgene plasmid # 195742 ; http://n2t.net/addgene:195742 ; RRID:Addgene_195742)
  • For your References section:

    Harnessing gut microbes for glycan detection and quantification. Modesto JL, Pearce VH, Townsend GE 2nd. Nat Commun. 2023 Jan 17;14(1):275. doi: 10.1038/s41467-022-35626-2. 10.1038/s41467-022-35626-2 PubMed 36650134