TRUPATH Triple Ga13
(Plasmid #196062)

• Purpose: Encodes a G alpha subunit (GNA13) with RLuc8, a G gamma subunit (GNG9) with GFP2 and a G beta subunit (GNB3) as optimal components of a BRET2 biosensor for studying heterotrimeric G proteins
• Depositing Lab: Justin English
• Depositing Organization: University of Utah
  Located in the United States of America
• Publication: Olsen et al Nat Chem Biol. 2020 May 4. pii: 10.1038/s41589-020-0535-8. doi: 10.1038/s41589-020-0535-8.

Backbone

• Vector backbone: pcDNA3.1(+)
• Backbone manufacturer: Genscript
• Backbone size w/o insert (bp): 5075
• Total vector size (bp): 9869
• Vector type: Mammalian Expression, Luciferase
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: GAlpha13-RLuc8
• Alt name: GNA13
• Species: H. sapiens (human)
• Insert Size (bp): 2100
• Mutation: RLuc8 and flanking SGGGGS linkers have been inserted at amino acid position 126 of the alpha subunit
• Entrez Gene: GNA13 (a.k.a. G13, HG1N)
• Promoter: CMV

Cloning Information for Gene/Insert 1

• Cloning method: Unknown
• 5′ sequencing primer: gccacgttgtgagttggatag
• 3′ sequencing primer: TAGAAGGCACAGTCGAGG

Gene/Insert 2

• Gene/Insert name: GGamma9-GFP2
• Alt name: GNG9
• Species: H. sapiens (human)
• Insert Size (bp): 939
• Promoter: CMV
• Tag / Fusion Protein:
  • GFP2 and GSAG linker (N terminal on insert)

Cloning Information for Gene/Insert 2

• Cloning method: Unknown
• 5′ sequencing primer: gagggcagaggaagtcttc
• 3′ sequencing primer: GATTTAGGTGACACTATAG

Gene/Insert 3

• Gene/Insert name: GBeta3
• Alt name: GNB3
• Species: H. sapiens (human)
• Insert Size (bp): 1020
• Entrez Gene: GNB3 (a.k.a. CSNB1H, HG2D)
• Promoter: CMV

Cloning Information for Gene/Insert 3

• Cloning method: Unknown
• 5′ sequencing primer: TGGGAGGTCTATATAAGCAGAGC
• 3′ sequencing primer: ccggtagggccgggattc

Resource Information

• A portion of this plasmid was derived from a plasmid made by: AddgeneTRUPATH Kit #1000000163

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Renilla Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry

DNA (Catalog # 196062-D50)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 50 μg
• Concentration: 1 μg/μL
• Pricing: $495 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Renilla Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

DNA (Catalog # 196062-D100)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 100 μg
• Concentration: 1 μg/μL
• Pricing: $585 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Renilla Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.