Skip to main content

YW347_Ptbb2UTR-loxP-RFP-miniMOS
(Plasmid #196064)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 196064 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCFJ910
  • Backbone size w/o insert (bp) 5496
  • Total vector size (bp) 7476
  • Vector type
    Worm Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    myo2p driven tagRFP
  • Species
    C. elegans (nematode)
  • Promoter myo-2

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer cattttatatctgagtagtacctttgc
  • 3′ sequencing primer ttacttgtacagctcgtccatg
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    NeoR
  • Species
    C. elegans (nematode)

Gene/Insert 3

  • Gene/Insert name
    Minimal Mos1
  • Species
    D. melanogaster (fly), C. elegans (nematode)

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    YW347_Ptbb2UTR-loxP-RFP-miniMOS was a gift from Wenxing Yang (Addgene plasmid # 196064 ; http://n2t.net/addgene:196064 ; RRID:Addgene_196064)
  • For your References section:

    A new miniMOS tool kit capable of visualizing single copy insertion in C. elegans. Li J, Qin Y, Shen C, Zhang J, Tu S, Yang J, Wang Y, Zhou R, Zhang K, Chen J, Yang W. PeerJ. 2023 May 17;11:e15433. doi: 10.7717/peerj.15433. eCollection 2023. 10.7717/peerj.15433 PubMed 37214099