Skip to main content
Addgene

pb-miRE-tre-3xFLAG-hnRNPU∆RGG
(Plasmid #196088)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 196088 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    piggyBac cargo vector
  • Backbone manufacturer
    System Biosciences
  • Total vector size (bp) 9257
  • Modifications to backbone
    Inserted TRE sequence between SpeI and AgeI sites. Inserted Kozak sequence, 3xFLAG tag sequence, SGS linker sequence, mouse hnrnpU CDS sequence lacking final 154 amino acids, and a stop codon between AgeI and SalI sites.
  • Vector type
    Mammalian Expression, Bacterial Expression
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    SAF-A
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1938
  • Mutation
    removed last 154 amino acids on cterminal end
  • Entrez Gene
    Hnrnpu (a.k.a. Hnrpu, SAFA, Sp120, hnRNP U)
  • Promoter TRE
  • Tag / Fusion Protein
    • N-terminal 3xFLAG (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SpeI (not destroyed)
  • 3′ cloning site AgeI (not destroyed)
  • 5′ sequencing primer TTTGAGCCTGCAGACACCTGG
  • 3′ sequencing primer gcctacctcgacatacgttct
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pb-miRE-tre-3xFLAG-hnRNPU∆RGG was a gift from Mauro Calabrese (Addgene plasmid # 196088 ; http://n2t.net/addgene:196088 ; RRID:Addgene_196088)
  • For your References section:

    SAFB associates with nascent RNAs and can promote gene expression in mouse embryonic stem cells. Cherney R, Eberhard Q, Giri G, Mills C, Porrello A, Zhang Z, White D, Trotman JB, Herring L, Dominguez D, Calabrese M. RNA. 2023 Jul 19:rna.079569.122. doi: 10.1261/rna.079569.122. 10.1261/rna.079569.122 PubMed 37468167