Skip to main content

CAGGS-safb∆dd1-NLS-3XFLAG-V5
(Plasmid #196092)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 196092 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    Addgene Plasmid #196383
  • Backbone manufacturer
    Genewiz
  • Total vector size (bp) 11069
  • Modifications to backbone
    Insertion of SAFB∆DD1 cDNA in AvrII and NotI sites.
  • Vector type
    Mammalian Expression, Bacterial Expression
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    SAFB
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    2277
  • Mutation
    Removed amino acids 96-285 (predicted disordered domain 1) of mouse SAFB protein
  • Entrez Gene
    Safb (a.k.a. 3110021E02Rik, 5330423C17Rik, E130307D12, HAP, HET, SAF-B1, SAFB1)
  • Promoter CAGGS
  • Tags / Fusion Proteins
    • C-terminal 3xFLAG (C terminal on backbone)
    • C-terminal V5 (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AvrII (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer GGCTCTAGAGCCTCTGCTAAC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Azenta (Genewiz)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CAGGS-safb∆dd1-NLS-3XFLAG-V5 was a gift from Mauro Calabrese (Addgene plasmid # 196092 ; http://n2t.net/addgene:196092 ; RRID:Addgene_196092)
  • For your References section:

    SAFB associates with nascent RNAs and can promote gene expression in mouse embryonic stem cells. Cherney R, Eberhard Q, Giri G, Mills C, Porrello A, Zhang Z, White D, Trotman JB, Herring L, Dominguez D, Calabrese M. RNA. 2023 Jul 19:rna.079569.122. doi: 10.1261/rna.079569.122. 10.1261/rna.079569.122 PubMed 37468167