CAGGS-SAFB-DD3-NLS-3XFLAG-V5
(Plasmid
#196095)
-
PurposeExpresses only the third computationally called disordered domain of mouse SAFB in mammalian cells. Contains a c-terminal 3xFlag tag and a c-terminal V5 tag
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 196095 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneAddgene Plasmid #196383
-
Backbone manufacturerGenewiz
- Total vector size (bp) 9736
-
Modifications to backboneInsertion of SAFB DD3 ONLY cDNA in AvrII and NotI sites.
-
Vector typeMammalian Expression, Bacterial Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSAFB
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)918
-
MutationContains only AA 619-925 (NLS and predicted disordered domain 3) of mouse SAFB protein
-
Entrez GeneSafb (a.k.a. 3110021E02Rik, 5330423C17Rik, E130307D12, HAP, HET, SAF-B1, SAFB1)
- Promoter CAGGS
-
Tags
/ Fusion Proteins
- C-terminal 3xFLAG (C terminal on backbone)
- C-terminal V5 (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AvrII (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer GGCTCTAGAGCCTCTGCTAAC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byAzenta (Genewiz)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CAGGS-SAFB-DD3-NLS-3XFLAG-V5 was a gift from Mauro Calabrese (Addgene plasmid # 196095 ; http://n2t.net/addgene:196095 ; RRID:Addgene_196095) -
For your References section:
SAFB associates with nascent RNAs and can promote gene expression in mouse embryonic stem cells. Cherney R, Eberhard Q, Giri G, Mills C, Porrello A, Zhang Z, White D, Trotman JB, Herring L, Dominguez D, Calabrese M. RNA. 2023 Jul 19:rna.079569.122. doi: 10.1261/rna.079569.122. 10.1261/rna.079569.122 PubMed 37468167