Skip to main content
Addgene

Lenti HBG site 2-ABE8e
(Plasmid #196099)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 196099 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    Adapted from lentiCRISPRv2
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Lenti HBG site 2-ABE8e
  • Species
    Synthetic

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ctgcagacaaatggcagta
  • 3′ sequencing primer TTAAGAATACCAGTCAATCTTTC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Lenti HBG site 2-ABE8e was a gift from Xiahui Zhang (Addgene plasmid # 196099 ; http://n2t.net/addgene:196099 ; RRID:Addgene_196099)
  • For your References section:

    Improving adenine and dual base editors through introduction of TadA-8e and Rad51DBD. Xue N, Liu X, Zhang D, Wu Y, Zhong Y, Wang J, Fan W, Jiang H, Zhu B, Ge X, Gonzalez RVL, Chen L, Zhang S, She P, Zhong Z, Sun J, Chen X, Wang L, Gu Z, Zhu P, Liu M, Li D, Zhong TP, Zhang X. Nat Commun. 2023 Mar 3;14(1):1224. doi: 10.1038/s41467-023-36887-1. 10.1038/s41467-023-36887-1 PubMed 36869044