Lenti HBG site 1-ABE8e
(Plasmid
#196101)
-
PurposeExpresses Lenti HBG site 1-ABE8e
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 196101 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneAdapted from lentiCRISPRv2
-
Vector typeMammalian Expression, Lentiviral, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLenti HBG site 1-ABE8e
-
SpeciesSynthetic
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ctgcagacaaatggcagta
- 3′ sequencing primer TTAAGAATACCAGTCAATCTTTC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Lenti HBG site 1-ABE8e was a gift from Xiahui Zhang (Addgene plasmid # 196101 ; http://n2t.net/addgene:196101 ; RRID:Addgene_196101) -
For your References section:
Improving adenine and dual base editors through introduction of TadA-8e and Rad51DBD. Xue N, Liu X, Zhang D, Wu Y, Zhong Y, Wang J, Fan W, Jiang H, Zhu B, Ge X, Gonzalez RVL, Chen L, Zhang S, She P, Zhong Z, Sun J, Chen X, Wang L, Gu Z, Zhu P, Liu M, Li D, Zhong TP, Zhang X. Nat Commun. 2023 Mar 3;14(1):1224. doi: 10.1038/s41467-023-36887-1. 10.1038/s41467-023-36887-1 PubMed 36869044