pGEM-SNAP-TRIM21
(Plasmid
#196181)
-
PurposeFor in vitro transcription of SNAP-TRIM21 mRNA
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 196181 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepGEM-HE
-
Vector typein vitro transcription
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameSNAP-TRIM21
-
SpeciesM. musculus (mouse)
-
Entrez GeneTrim21 (a.k.a. Ro52, Ssa1)
- Promoter T7
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GGTTTAGTGGTAACCAGATCAAGC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe original SNAP tag sequence was obtained from NEB pSNAPf vector (NEB, N9183S)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGEM-SNAP-TRIM21 was a gift from Binyam Mogessie (Addgene plasmid # 196181 ; http://n2t.net/addgene:196181 ; RRID:Addgene_196181) -
For your References section:
Actin limits egg aneuploidies associated with female reproductive aging. Dunkley S, Mogessie B. Sci Adv. 2023 Jan 20;9(3):eadc9161. doi: 10.1126/sciadv.adc9161. Epub 2023 Jan 20. 10.1126/sciadv.adc9161 PubMed 36662854