Skip to main content

pS-cr:GFP
(Plasmid #196295)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 196295 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCB301-2μ-HDV
  • Vector type
    Plant Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Full length TSWV S antigenome encoding crRNA:GFP fusion in place of viral NSs
  • Alt name
    SpeI-DR-BsaI-BsaI-DR-GFP-SpeI
  • gRNA/shRNA sequence
    ggagaccgaggtccgaggtctcc
  • Species
    Synthetic
  • Promoter duplicated cauliflower mosaic virus 35S promoter
  • Tag / Fusion Protein
    • SpeI-DR-BsaI-DR-SpeI (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SpeI (not destroyed)
  • 3′ cloning site SpeI (not destroyed)
  • 5′ sequencing primer 35S promoter/forwarad primer: CTATCCTTCGCAAGACCCTTC
  • 3′ sequencing primer Nos terminator/reverse primer: TCATCGCAAGACCGGCAA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pS-cr:GFP was a gift from Zhenghe Li (Addgene plasmid # 196295 ; http://n2t.net/addgene:196295 ; RRID:Addgene_196295)
  • For your References section:

    Engineered biocontainable RNA virus vectors for non-transgenic genome editing across crop species and genotypes. Liu Q, Zhao C, Sun K, Deng Y, Li Z. Mol Plant. 2023 Mar 6;16(3):616-631. doi: 10.1016/j.molp.2023.02.003. Epub 2023 Feb 7. 10.1016/j.molp.2023.02.003 PubMed 36751129