pGD-p19
(Plasmid
#196326)
-
Purpose35S promoter-driven expression of the tomato bushy stunt virus p19 RNA silencing suppressor
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 196326 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepGD
-
Vector typePlant Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nametomato bushy stunt virus p19
-
Alt nameTBSV p19
-
SpeciesVIRUS
-
Insert Size (bp)519
- Promoter duplicated cauliflower mosaic virus 35S promoter
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer 35S promoter/forward primer: CTATCCTTCGCAAGACCCTTC
- 3′ sequencing primer Nos terminator/reverse primer: TCATCGCAAGACCGGCAA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGD-p19 was a gift from Zhenghe Li (Addgene plasmid # 196326 ; http://n2t.net/addgene:196326 ; RRID:Addgene_196326) -
For your References section:
Construction of a Sonchus Yellow Net Virus minireplicon: a step toward reverse genetic analysis of plant negative-strand RNA viruses. Ganesan U, Bragg JN, Deng M, Marr S, Lee MY, Qian S, Shi M, Kappel J, Peters C, Lee Y, Goodin MM, Dietzgen RG, Li Z, Jackson AO. J Virol. 2013 Oct;87(19):10598-611. doi: 10.1128/JVI.01397-13. Epub 2013 Jul 24. 10.1128/JVI.01397-13 PubMed 23885070
Map uploaded by the depositor.
