Skip to main content

pP2-phiV10
(Plasmid #196333)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 196333 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    4A3
  • Total vector size (bp) 3629
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    chimeric tail fiber P2-phiV10
  • Species
    phage P2 and phiV10
  • Insert Size (bp)
    2451
  • Promoter P2 late promoter

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer CGTATCACGAGGCAGAATTTC
  • 3′ sequencing primer ctttcgggctttgttagcag
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pP2-phiV10 was a gift from Baojun Wang (Addgene plasmid # 196333 ; http://n2t.net/addgene:196333 ; RRID:Addgene_196333)
  • For your References section:

    Tail-Engineered Phage P2 Enables Delivery of Antimicrobials into Multiple Gut Pathogens. Fa-Arun J, Huan YW, Darmon E, Wang B. ACS Synth Biol. 2023 Feb 17;12(2):596-607. doi: 10.1021/acssynbio.2c00615. Epub 2023 Feb 2. 10.1021/acssynbio.2c00615 PubMed 36731126