pP2-P1(S')
(Plasmid
#196334)
-
PurposePlasmid expressing chimeric P2-P1(S') tail fiber
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 196334 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbone4A3
- Backbone size w/o insert (bp) 3639
- Total vector size (bp) 6869
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namechimeric tail fiber P2-P1(S') and chaperone protein U'
-
Speciesphage P2 and P1
-
Insert Size (bp)3230
- Promoter P2 late promoter
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CGTATCACGAGGCAGAATTTC
- 3′ sequencing primer ctttcgggctttgttagcag
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pP2-P1(S') was a gift from Baojun Wang (Addgene plasmid # 196334 ; http://n2t.net/addgene:196334 ; RRID:Addgene_196334) -
For your References section:
Tail-Engineered Phage P2 Enables Delivery of Antimicrobials into Multiple Gut Pathogens. Fa-Arun J, Huan YW, Darmon E, Wang B. ACS Synth Biol. 2023 Feb 17;12(2):596-607. doi: 10.1021/acssynbio.2c00615. Epub 2023 Feb 2. 10.1021/acssynbio.2c00615 PubMed 36731126