AAV-GfaABC1D-iCreV-4x6T
(Plasmid #196412)

• Purpose: Astrocytic expression of light-inducible iCreV recombinase in AAV; astrocyte specificity enhanced with 4x6T miRNA targeting cassette
• Depositing Lab: Stanley Thomas Carmichael
• Publication: Gleichman et al Nat Commun. 2023 Nov 16;14(1):7426. doi: 10.1038/s41467-023-42746-w.

Backbone

• Vector backbone: pAAV-MCS
• Backbone manufacturer: Stratagene
• Backbone size w/o insert (bp): 3406
• Total vector size (bp): 6855
• Modifications to backbone: The GfaABC1D promoter and the 4x6T miRNA targeting cassette were added to confer astrocyte specificity.
• Vector type: Mammalian Expression, AAV ; Astrocyte-selective

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: iCreV
• Alt name: Light-inducible Cre recombinase
• Species: Synthetic
• Insert Size (bp): 2040
• Promoter: GfaABC1D

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: tagcccactccttcataaag
• 3′ sequencing primer: ttattaggacaaggctggtg

Resource Information

• Supplemental Documents:
  • aav-gfaabc1d-icrev-4x6t.gb
• A portion of this plasmid was derived from a plasmid made by: AAV-GfaABC1D-iCreV-4x6T was created using AAV pmSyn1-EBFP-Cre (Addgene 51507) provided by Hongkui Zeng and iCreV (Addgene 140135) provided by Hongkui Zeng.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://www.biorxiv.org/content/10.1101/2023.02.21.529451v2 for bioRxiv preprint.