-
Purpose(Empty Backbone) Empty vector for astrocyte-selective expression in AAV; astrocyte specificity enhanced with 4x6T miRNA targeting cassette
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 196417 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepAAV-MCS
-
Backbone manufacturerStratagene
- Backbone size (bp) 3406
-
Modifications to backboneThe GfaABC1D promoter and the 4x6T miRNA targeting cassette were added to confer astrocyte specificity.
-
Vector typeMammalian Expression, AAV ; Astrocyte-selective
- Promoter GfaABC1D
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer tagcccactccttcataaag
- 3′ sequencing primer ttattaggacaaggctggtg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byAAV-GfaABC1D-MCS--4x6T was created using AAV pmSyn1-EBFP-Cre (Addgene 51507) provided by Hongkui Zeng.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2023.02.21.529451v2 for bioRxiv preprint.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV-GfaABC1D-MCS--4x6T-WPRE was a gift from Stanley Thomas Carmichael (Addgene plasmid # 196417 ; http://n2t.net/addgene:196417 ; RRID:Addgene_196417) -
For your References section:
A toolbox of astrocyte-specific, serotype-independent adeno-associated viral vectors using microRNA targeting sequences. Gleichman AJ, Kawaguchi R, Sofroniew MV, Carmichael ST. Nat Commun. 2023 Nov 16;14(1):7426. doi: 10.1038/s41467-023-42746-w. 10.1038/s41467-023-42746-w PubMed 37973910
Map uploaded by the depositor.
