plentiCMV-sct-pp65-b2m-HLA-A0201
(Plasmid
#196511)
-
PurposeExpress single-chain peptide-MHC (pp65 CMV epitope on HLA-A0201)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 196511 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLentiCMV-WPRE
- Backbone size w/o insert (bp) 6647
- Total vector size (bp) 7200
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersNA
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesingle chain of a pp65 peptide, b2m and HLA A0201
-
SpeciesH. sapiens (human), Synthetic
-
Insert Size (bp)1452
-
MutationY84C
- Promoter CMV
-
Tag
/ Fusion Protein
- NA
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GTAGGCGTGTACGGTGGGAG
- 3′ sequencing primer AAGCAGCGTATCCACATAGCG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
plentiCMV-sct-pp65-b2m-HLA-A0201 was a gift from Howard Chang (Addgene plasmid # 196511 ; http://n2t.net/addgene:196511 ; RRID:Addgene_196511) -
For your References section:
Engineered cell entry links receptor biology with single-cell genomics. Yu B, Shi Q, Belk JA, Yost KE, Parker KR, Li R, Liu BB, Huang H, Lingwood D, Greenleaf WJ, Davis MM, Satpathy AT, Chang HY. Cell. 2022 Dec 22;185(26):4904-4920.e22. doi: 10.1016/j.cell.2022.11.016. Epub 2022 Dec 13. 10.1016/j.cell.2022.11.016 PubMed 36516854