psiCHECK-EGFP
(Plasmid
#196606)
-
PurposeDual-Luciferase Reporter vector carrying an EGFP direct sequence
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 196606 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepsiCHECK2-XNS
- Backbone size w/o insert (bp) 6173
- Total vector size (bp) 7018
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGFP
-
SpeciesAequorea victoria
-
Insert Size (bp)717
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (not destroyed)
- 3′ cloning site SalI (destroyed during cloning)
- 5′ sequencing primer atcaagagcttcgtggagcg
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
psiCHECK-EGFP was a gift from Franco Lucchini (Addgene plasmid # 196606 ; http://n2t.net/addgene:196606 ; RRID:Addgene_196606) -
For your References section:
siRNAs pools generated in Escherichia coli exhibit strong RNA-interference activity against influenza virus genomic sequences. Villa R, Renzi S, Dotti S, Lucchini F. Virology. 2022 Dec 31;579:38-45. doi: 10.1016/j.virol.2022.12.013. 10.1016/j.virol.2022.12.013 PubMed 36599198