pBAD-P19-NP
(Plasmid
#196608)
-
PurposesiRNA vector expressing TMV P19 and a 425bp-long NP sequence as inverted repeat
-
Depositing Lab
-
Depositing OrganizationUniversità Cattolica del Sacro Cuore, Facoltà di Scienze Agrarie
Located in Italy -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 196608 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepBAD-p19-GFP
- Backbone size w/o insert (bp) 6546
- Total vector size (bp) 6148
-
Modifications to backboneThe p19-T7_NP cassette was cloned from pGEX-4T-1-p19-T7-NP
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)SURE
-
Growth instructionsInverted repeat is unstable. Check plasmid by restriction every time.
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namep19 + Influenza virus NP inverted repeat
-
gRNA/shRNA sequenceInfluenza virus NP
-
SpeciesTomato bushy stunt virus, influenza A virus
-
GenBank IDAJ288942 CY116459
-
Tags
/ Fusion Proteins
- 6x His tag (N terminal on backbone)
- 6x His tag (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BglII (destroyed during cloning)
- 3′ cloning site PstI (not destroyed)
- 5′ sequencing primer tctctactgtttctccatacccg
- 3′ sequencing primer gcgtatcacgaggccctttc
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBAD-P19-NP was a gift from Franco Lucchini (Addgene plasmid # 196608 ; http://n2t.net/addgene:196608 ; RRID:Addgene_196608) -
For your References section:
siRNAs pools generated in Escherichia coli exhibit strong RNA-interference activity against influenza virus genomic sequences. Villa R, Renzi S, Dotti S, Lucchini F. Virology. 2022 Dec 31;579:38-45. doi: 10.1016/j.virol.2022.12.013. 10.1016/j.virol.2022.12.013 PubMed 36599198