Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pBAD-P19-NP
(Plasmid #196608)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 196608 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pBAD-p19-GFP
  • Backbone size w/o insert (bp) 6546
  • Total vector size (bp) 6148
  • Modifications to backbone
    The p19-T7_NP cassette was cloned from pGEX-4T-1-p19-T7-NP
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    SURE
  • Growth instructions
    Inverted repeat is unstable. Check plasmid by restriction every time.
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    p19 + Influenza virus NP inverted repeat
  • gRNA/shRNA sequence
    Influenza virus NP
  • Species
    Tomato bushy stunt virus, influenza A virus
  • GenBank ID
    AJ288942 CY116459
  • Tags / Fusion Proteins
    • 6x His tag (N terminal on backbone)
    • 6x His tag (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (destroyed during cloning)
  • 3′ cloning site PstI (not destroyed)
  • 5′ sequencing primer tctctactgtttctccatacccg
  • 3′ sequencing primer gcgtatcacgaggccctttc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBAD-P19-NP was a gift from Franco Lucchini (Addgene plasmid # 196608 ; http://n2t.net/addgene:196608 ; RRID:Addgene_196608)
  • For your References section:

    siRNAs pools generated in Escherichia coli exhibit strong RNA-interference activity against influenza virus genomic sequences. Villa R, Renzi S, Dotti S, Lucchini F. Virology. 2022 Dec 31;579:38-45. doi: 10.1016/j.virol.2022.12.013. 10.1016/j.virol.2022.12.013 PubMed 36599198