Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pROS13-Tps2/Gsy1
(Plasmid #196613)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 196613 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pROS13
  • Vector type
    Yeast Expression
  • Selectable markers
    kanMX (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    S000001911
  • Alt name
    S000001911
  • Alt name
    S000002481
  • gRNA/shRNA sequence
    TPS2: ATTTTGGAAACAAATTCTAT, GSY1: CAATCTACAGTATTTTGATG
  • Species
    S. cerevisiae (budding yeast)
  • Entrez Gene
    TPS2 (a.k.a. YDR074W, HOG2, PFK3)
  • Entrez Gene
    GSY1 (a.k.a. YFR015C)
  • Promoter SNR52

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CACCTTTCGAGAGGACGATG
  • 3′ sequencing primer GCTGGCCTTTTGCTCACATG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Cloning details are in the Methods section and Supplementary Table 2 of the paper.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pROS13-Tps2/Gsy1 was a gift from Matthias Heinemann (Addgene plasmid # 196613 ; http://n2t.net/addgene:196613 ; RRID:Addgene_196613)
  • For your References section:

    Temporal segregation of biosynthetic processes is responsible for metabolic oscillations during the budding yeast cell cycle. Takhaveev V, Ozsezen S, Smith EN, Zylstra A, Chaillet ML, Chen H, Papagiannakis A, Milias-Argeitis A, Heinemann M. Nat Metab. 2023 Feb;5(2):294-313. doi: 10.1038/s42255-023-00741-x. Epub 2023 Feb 27. 10.1038/s42255-023-00741-x PubMed 36849832